Pharmacophore an International Research Journal
Pharmacophore
Submit Manuscript
Open Access | Published: 2021 - Issue 4

THE ROLE OF P53 AND K-RAS IN REGULATING SPLEEN INNATE MEDIATORS IN MICE WITH COLON CANCER

Sahar El Hadad1,2*, Eman Al Rowily1, Alia Aldahlawi1,3, Jehan Alrahimi1,3, Shahira Hassoubah1

 

  1. Department of Biological Science, Faculty of Science, King Abdulaziz University, Jeddah, KSA.
  2. Research Center of Genetic Engineering and Bioinformatics, VACSERA, Cairo, Egypt.
  3. Immunology Unit, King Fahad for Medical Research, King Abdulaziz University, Jeddah, KSA.

ABSTRACT

The spleen is a secondary lymphoid organ that embraces several immune cells. It possesses an anti-tumor impact where splenectomies correlated directly to a significant increase of malignant tumor induction. The unmutant p53 and K-ras genes are expressed at low levels and play an essential role in the apoptosis of corrupted cells. We studied the impacts of p53 and K-ras transcriptions in some innated mediators' expressions on the spleen of mice bearing colon cancer. A number of Swiss mice were categorized into the untreated negative control group, and mice were injected with Azoxymethane carcinogen for colon cancer induction (AOM group). Both groups were subjected to TLR1, TLR2, IL1b, TNFa, IFNg, p53, and K-ras expression levels estimations after 4, 8, and 10 weeks from colon cancer induction. A significant increase in the p53 transcription level was observed at week 10, whilst K-ras transcription level upregulated significantly only at week 8 in the AOM group compared to the untreated group. The AOM spleen cells showed a late (weeks 8 and 10) significant upregulation and transcriptions on TLR1, TLR2, TNFa, and IFNg, levels, however, the IL1b transcription showed an early significant downregulation in comparison to those of the untreated group. Moreover, p53 transcription showed a significant correlation with TLR1 and TLR2 expressions, while K-ras transcription showed a significant correlation to the IL1b, TNFa, and IFNg, transcriptions levels. The study gave an insight into the confirmed correlation of p53 and K-ras transcriptions of mice spleen to some innate mediators during the induction of colon cancer.

Keywords: Colon cancer, TLR, IL1b, p53, K-ras, Spleen


Introduction

The spleen is the biggest lymphoid member in the body and besides its role in hematopoiesis and red blood cell clearance it has a wide range of immunologic functions [1]. Spleen is also considered the largest natural reservoir of immune cells including natural killer cells, neutrophils, monocytes, and lymphocytes [2]. The main immunological function of the spleen is to mount an immune response and remove micro-organisms from circulation; these functions are accomplished through two functional compartments of spleen; the first one is the red pulp region which removes pathogens and cellular debris and the second one is the white pulp regions of the spleen that contain the lymphocytes which initiate adaptive immune response [3, 4]. The spleen also has a very important role in the anti-tumor immune system and this role has become clear since many modern studies linked between splenectomy and cancer development in mice and rats, species; splenectomies rats and mice showed a significant increase of malignant tumor induction. Epidemiological studies also have found that the risk of cancer development is increased when the spleen is removed [5, 6].

Cancer is a global health problem that is associated with high mortality rates around the world [7, 8] and colon cancer, in particular, accounts for approximately 11% of all annually diagnosed cancer and cancer-related deaths around the world [9]. The development of colon cancer depends on many factors where both hereditary and environmental play important roles. The risk factors include decreased physical activity, obesity, excessive consumption of processed food and red meat, alcohol, and smoking [10-12]. Epidemiological studies show that male gender and age increasing have a strong association with colon cancer incidence where statistics show that approximately 10-20% of all patients with colon cancer have a positive family history [11].

A variety of factors have contributed to the process of transformation of a normal cell towards a cancerous cell. This process has several stages of epigenetic and genetic changes that confer selective advantages upon the altered cells [13]. Generally, cancer-related genes are divided into 2 classes, tumor suppressor genes and proto-oncogenes [14]. P53 gene is one of the most important tumor suppressor genes that play a key role in the regulation process of various signaling pathways, as a tumor suppressor, p53 plays various significant roles including the ability to arrest cell cycle, apoptosis senescence, and DNA repair [13, 15]. The p53 gene is inactive and commonly mutated in the majority of cancers it is considered the second most frequent mutation observed in colorectal cancer and many p53 mutants can promote tumor growth through several ways [13, 16]. Proto-oncogenes are involved in pathways that promote cell growth; these genes lead normal cells to be cancerous when they are activated by alterations or mutations, mutations in proto-oncogenes are usually dominant, and their mutated versions are known as oncogenes [14]. K-ras gene is an oncogene that encodes K-ras, a small GTPase transductor protein involved in regulating cell division due to its ability to transform external signals into the cell nucleus [17]. K-ras mutations are predominant in several human cancers and have been found in 52% of colorectal cancer patients [18]. Since the mice spleen considered as the occupants of many immune cells in particular monocytes and macrophages, this study investigated the correlation between spleen p53 and K-ras transcriptions and some innate mediators during the early stages of colon cancer induction.

 

Materials and Methods

 

Induction of Colon Cancer in Experimental Animal

Forty Swiss male mice (20-25 g, 6-8 weeks old) were maintained in the Animal House Unit at the King Fahd Medical Research Center, King Abdul-Aziz University, KSA. Azoxymethane (AOM; Sigma-Aldrich St. Louis, MO, Cat NO A5486) is a chemical carcinogen used to induce colon cancer in animals [19]. The mice were randomly sorted into two groups: negative untreated control (C group), and mice group received four IP injections of 10mg/kg AOM over eight weeks, from week 0 to week 7, to induce colon cancer tumorigenesis; then, they were left untreated till the end of week 10 (AOM group). Next, five mice from C and AOM groups were sacrificed at weeks 4, 8, and 10, and all efforts were made to minimize the suffering. Finally, their spleen samples were collected and stored at -80°C until use.

 

Estimation of Gene Expression Levels in Mice

The mRNA extractions were performed using the RNeasy Mini kit (QIAGEN, Cat No. 75162) from the mice spleen tissues preserved in RNA later (QIAGEN, Cat NO. 76106) according to the manufacturer's protocol. The QuantiTect SYBR Green RT-qPCR Kit Master Mix reagents (QIAGEN Cat No. 204243) and sets of IL-1β, TLR1, TLR 2, IFN-γ, TNFα, p53, and K-ras specific primers (Table 1) were used to evaluate the transcriptions levels as described by Elbanna et al. [20] and Hadad et al. [21]. Transcriptions relative ratio levels of the target genes were estimated according to the 2-ΔΔCt method in comparison with the GAPDH gene transcription as a housekeeping gene [22].

 

Table 1. Primers Used for Genes Expression Quantitation Using SYBER Green qRT-PCR

Gene

Polarity

Primer sequence (5'---'3)

Primer length

Nucleotide positions

GenBank References

GAPDH

F

R

GTTGTCTCCTGCGACTTCA

GGTGGTCCAGGGTTTCTTA

19

19

1356-1374

1649-1631

XM_017321385

TLR1

F

R

TCAAGCATTTGGACCTCTCCT

TTGTACCCGAGAACCGCTCA

21

20

824-844

933-914

NM_001276445

TLR2

F

R

AACCTCAGACAAAGCGTCAAATC

ACCAAGATCCAGAAGAGCCAAA

23

22

323-345

387-366

NM_011905.3

IFNγ

F

R

GGCCATCAGCAACAACATAAGCGT

TGGGTTGTTGACCTCAAACTTGGC

24

24

364-387

481-458

NM_008337.4

TNFα

F

R

ATGAGCACAGAAAGCATGA

AGTAGACAGAAGAGCGTGGT

19

20

157-175

308-289

AB185894.1

IL1β

F

R

TCATGGGATGATGATGATAACCTGCT

CCCATACTTTAGGAAGACACGGATT

26

25

960-985

1462-1458

XM_006498795

P53

F

R

ACACCTGATCGTTACTCGGCTTGT

AAATTACAGACCTGGTGGCTCA

24

22

674-697

887-865

X_60470.1

Kras

F

R

AGGCCTGCTGAAAATGACTG

TCTATCGTAGGGTCGTACTCATC

20

23

242-261

146-168

XM_032905399.1

             

 

Statistical Methods

The statistical evaluations between the groups were performed using Megastat software version 10.1. One-way ANOVA parametric tests were performed for obtaining the relative ratios of the gene expressions. A P value <0.05 was deemed significant. In addition, the correlation matrix analysis test was used for obtaining the correlation analysis between the p53, K-ras and the current immunological markers.

 

Results and Discussion

Influence of AOM p53 and K-ras Transcriptions

By weeks 4, the p53 expression level diminished non significantly in the spleen cells of the AOM group in comparison with its level in the untreated group, whereas its expression was increased non significantly at week 8. Finally, by week 10, the p53 transcription level increased extremely and significantly in the AOM group compared to its corresponding levels in the control group (P=0.0000) (Figure 1). Moreover, the transcription level of K-ras in the spleen cells of the AOM group fluctuated non-significantly when compared with its levels in the untreated group at weeks 4 and 10. By week 8, the transcription of the current oncogene was upregulated significantly in the AOM group when compared with its level in the untreated group (P=0.005) (Figure 1).

a)

b)

Figure 1. The Relative Ratio of p53/mRNA and K-ras/mRNA Transcriptions Levels in Different Mice Spleen

Where group C represented mice untreated negative control, and the AOM group represented mice injected with AOM for inducing colon cancer. (*) Significant at P<0.05 as determined by ANOVA and One-factor ANOVA test. Each point represented the mean value of 3 tests and the vertical bars denote the mean±5%.

 

Influence of AOM on Toll-like Receptors 1 and 2 Transcriptions

By weeks 4 and 8, the transcription levels of TLR1 increased in the spleen cells of the AOM mice group in comparison to the levels in the untreated group; however, this change was non-significant. On the other hand, and by week 10, the TLR1 transcription level was significantly enhanced in the AOM group when compared with the levels in untreated mice (P=0.0024) (Figure 2). Furthermore, and by weeks 4 and 10, the TLR2 transcription level fluctuated non-significantly in the spleen cells of the AOM group when compared with its level in the control group; meanwhile, the expression levels significantly increased in the AOM group in comparison to the levels in the untreated group after eight weeks from inducing mice colon cancer (P=0.019) (Figure 2).

a)

b)

Figure 2. The Relative Ratio of TLR1/mRNA and TLR2/mRNA Transcriptions Levels in Different Mice Spleen

 

Where group C represented mice untreated negative control, and the AOM group represented mice injected with AOM for inducing colon cancer. (*) Significant at P<0.05 as determined by ANOVA and One-factor ANOVA test. Each point represented the mean value of 3 tests and the vertical bars denote the mean±5%.

 

Influence of AOM on Pro-inflammatory Cytokines Transcriptions

During all the current experiment durations, the transcription level of the cytokine, IL Iβ, downregulated extremely significantly in the AOM group when compared with its level in the untreated group (P=0.0000 per each duration) (Figure 3). By weeks 4 and 10, the transcription of TNFα was upregulated non-significantly in the spleen cells of the AOM group in comparison to the control group; Moreover, it was upregulated significantly after eight weeks compared to the TNFα level in the control group (P=0.0237) (Figure 3). Furthermore, by weeks 4 and 8, no noticeable differences were remarked between the expression levels of IFNg in the spleen cells of either AOM, or the untreated groups, whereas, at week ten, it was significantly upregulated in the spleen cells of the AOM mice group in comparison with its transcription levels in the control group (P=0.0019) (Figure 3).

 

a)

b)

c)

Figure 3. The Relative Ratio of IL1β/mRNA, TNFα/mRNA and IFNγ/mRNA Transcriptions Levels in Different Mice Spleen

 

Where group C represented mice untreated negative control, and the AOM group represented mice injected with AOM for inducing colon cancer. (*) Significant at P<0.05 as determined by ANOVA and One-factor ANOVA test. Each point represented the mean value of 3 tests and the vertical bars denote the mean±5%.

 

Transcription Relative Ratio Correlation Analysis between the p53 and the Current Innate Mediators

At week 4, the correlation transcriptions analysis of p53 in spleen cells of mice bearing colon cancer and the present immunological markers demonstrated a positive significant correlation to the TLR2 (P<0.01) transcription; meanwhile, it was remarked negative significant negative correlation to TLR1 (P<0.01) transcription. A nonsignificant correlation was observed between the current tumor suppressor gene transcription to both IL1β and TNFα gene expression (Positive manner), and IFNγ gene expression (negative manner) (Table 2). By week 8, the transcription of the AOM-p53 gene in mice spleen cells presented an extremely significant positive correlation to TLR2 transcription (P>0.01). In addition, it was still demonstrated a non-significant correlation to the TNFα gene (Positive manner), and to TLR1, IFNγ, and IL1β expressions (negative manner) (Table 2). At week 10, p53 transcription on the spleen cells of the AOM group verified a positive correlation to TLR2 and TNFα transcriptions and correlated negatively with IFNγ, IL1β transcription; however, this correlation was in a nonsignificant manner. The current tumor suppressor gene illustrated a significant negative correlation to TLR1 transcription (P>0.05) (Table 2).

 

Table 2. Correlations Analysis of the Relative Ratio Transcription Levels of the Present p53 Expressions and the Immunological Markers in the Spleen of Mice Bearing Colon Cancer

Durations

TLR1

TLR2

IFNγ

IL1β

TNFα

4 w

-0.911

0.989

-0.055

0.072

0.062

8 w

-0.655

0.899

-0.072

-0.298

0.485

10 w

-0.795

0.675

-0.102

-0.159

0.135

Number of samples =8, Red numbers represented negative correlations; Black numbers represented positive correlations; 0.707 critical value <0 .05 (two-tail); 0.834 critical value< 0 .01 (two-tail)

 

Transcription Relative Ratio Correlation Analysis between the K-ras and the Current Innate Mediators

At week 4, K-ras transcription verified a positive correlation with either TLR1, or IFNγ expressions, and a negative correlation with either TLR2, ILIβ, or TNFα transcriptions; however, these correlations were nonsignificant (Table 3). These correlations were reversed by week 8; but this oncogene transcription demonstrated a nonsignificant correlation to TLR2, IL1β, and TNFα in a positive manner, and a negative correlation to TLR1, and IFNγ transcriptions (Table 3). At week 10; K-ras gene expression was reported to have a strong significant positive relationship with the expression of the IL1β gene (P<0.01) and a non-significant positive relation with IFNγ expression. Meanwhile, K-ras has a significant negative correlation with TNFα and a non-significant negative correlation with TLR1 and TLR2 expressions (P<0.05) (Table 3).

 

Table 3. Correlations Analysis of the Relative Ratio Transcription Levels of the Present K-ras Expressions and the Immunological Markers in the Spleen of Mice Bearing Colon Cancer

Durations

TLR1

TLR2

IFNγ

IL1β

TNFα

4 w

0.085

-0.020

0.349

-0.499

-0.443

8 w

-0.387

0.322

-0.690

0.320

0.538

10 w

-0.341

-0.683

0.420

0.857

-0.787

Number of samples =8, Red numbers represented negative correlations; Black numbers represented positive correlations; 0.707 critical value <0 .05 (two-tail); 0.834 critical value< 0 .01 (two-tail)

 

When the growth rate of the cancer is offensive, the host immunological response is defeated or destroyed easily due to the uncontrolled rise in the number of cancer cells [23]. The spleen is not only an immune organ that provides an antitumor effect because of its enrichment with numerous types of lymphocytes and macrophages [24] but also, it seems to be a very antagonistic area for the establishment of cancerous cells from different organs [25]. p53 is a nuclear transcription factor that transactivates several target genes involved in the apoptosis and/or cell cycle arrest [26-28]. K-RAS is one of the RAS family isoforms - an example of an oncogene- [29], which have many cellular functions, such as proliferation, growth, migration, differentiation, apoptosis, and division of the cells. The natural, unchanged form of the gene is called wild-type K-RAS [29]. Mutations in the RAS gene were first reported in cancer over 30 years ago, while mutations in K-RAS account for about 85% of all RAS mutations in human tumors [30]. In the current study, the most significant upregulation of the p53 transcription in the spleen cells of the AOM group was observed at week ten from the induction of colon cancer. Meanwhile, the present K-ras transcription upregulation fluctuated during the current experiment, whereas the most significant upregulation was observed in the AOM spleen cells group after eight weeks from inducing colon cancer compared to the normal control group. In normal circumstances, p53 is a transcript at a remarkably low level [31] and as a functionally inert form. When DNA is damaged, p53 accumulates in the nucleus throughout post-translational modifications. These modifications activate p53 [32]. Under specific conditions related to the induction of colon cancer using AOM, the present p53 transcription of the AOM spleen cells group succeeded in activating the functional form of p53. The active form of p53 transactivates target genes and induces cell cycle arrest and apoptosis, which is dependent on the type and extent of DNA damage [26, 28, 33]. p53-mediated cell cycle suppression permits cells to repair damaged DNA that has been confirmed. When DNA is repaired, the cell re-enters its normal cycle. However, when cells have severe DNA damage, p53 exerts its pro-apoptotic function and eliminates the cell and thereby inhibits the transfer of damaged DNA to daughter cells. Therefore, p53 can maintain genomic integrity [34]. Otherwise, little is known about the correlation between the unchanged/wiled type K-ras transcription activity and the early stages of colon cancer induction. We analyzed the associations between p53, K-ras, transcription, and the TLRs -specifically TLR1 (CD281) and TLR2 (CD281)-, as well as their correlations with the pro-inflammatory cytokines as an immune guardian against tumor development. Both TLR1 and TLR2 activation are essential for innate immune monitoring, which activates and regulates either the macrophages or the dendritic cells to respond in the systemic areas [35]. Commonly, TLR1 and TLR2 play crucial roles in this immunomodulatory effect. From our results analysis, the current K-ras transcription showed a non-significant correlation with either TLR1 and TLR2 transcriptions in the spleen cells of the AOM group, whilst p53 transcription – a tumor suppressor gene- was correlated significantly with TLR1 (in a positive manner) and TLR2 transcriptions (in a negative manner). Our result confirmed the suggestion of several studies about the vital role of the p53 as a DNA damage regulator and as a TLRs gene transcription controller [36] in the spleen cells during the induction of colon cancer. However, the current K-ras transcription results did not announce any role in the TLR1 or TLR2 expression regulation under the same circumstances. The upregulation of the pro-inflammatory cytokine cascade is commonly correlated directly to the upregulation of TLRs expression levels. The early activation of the pro-inflammatory cytokines expressions is a revolution against tumorigenesis and protecting its development by increasing the apoptosis pathway of cancerous cells [37]. Although TNFα and IL1β are generated by monocytes, in particular, the macrophages (the most effective antigen-presenting cells) [38, 39]. The spleen is the main residential area of monocytes and macrophages, so it is considered an essential source of different pro-inflammatory cytokines that are released in response to several pathogenic diseases and tumor induction [40]. The Th1 lymphocytes are the main producers of the IFN-γ cytokine, where it is providing an immunological shield against tumor survival [41]. In this investigation, a nonsignificant relationship was reported between the p53 transcription and the present pro-inflammatory cytokines -IL1b, TNFa, and IFNg- expressions during the periods of the experiment. Besides, the further current analysis confirmed a significant correlation between K-ras expression and the IL-1b (in a positive manner) and TNFa (in a negative manner) expressions on the spleen cells of the AOM group. These current results supported multiple studies that discussed the effects of macro-autophagy inhibition in the spread of K-ras-driven malignancies, which may be resulted from the increase of disabled mitochondria, and raised levels of reactive oxygen species, which also restricts tumor survival and expansion [42]. Macro-autophagy or autophagy -a process of degrades the large macromolecular complexes and eliminates corrupted organelles- is a tumor-suppressive mechanism, however, it also can improve oncogenesis in established K-ras dependent cancers [43]. Autophagic proteins have significant actions in the regulation of inflammatory mediators, so it will influence cytokines produced from macrophages [44]. It has been established that autophagy inducement is affected by numerous cytokines, including TGFβ, IL-1, IL-2, IL-6, TNFα, IFNγ, and [45, 46]. Stimulation of macrophages with IFNγ may lead to the elevated pathogens intracellular killing. However, TNF blockers suppress the maturation of the IFNγ-induced phagosome, implying that maturation and autophagy of the IFNγ-induced phagosome might be TNFα dependent. Notably, TNFα is demonstrated to pretend a role in activating autophagy in several types of cells by using different actions and mechanisms [47]. Moreover, IL 1 has been demonstrated to stimulate autophagy [12]. However, insulin-like growth factor 1 [48] and fibroblast growth factor 2 both can inhibit autophagy [8].

 

Conclusion

 

In conclusion, the current study gave an insight into the immunomodulatory effect of p53 and K-ras transcriptions of mice spleen - a part of the systemic immune system- pro-inflammatory cytokines and TLRs during the induction of colon cancer using Azoxymethane. The correlation results analysis verified a significant correlation between the p53 and the TLR1 and TLR2, whilst it correlated non-significantly with the pro-inflammatory cytokines’ transcription. Moreover, K-ras transcription correlated significantly to the present pro-inflammatory -IL1b and TNFα- cytokines transcriptions whilst it correlated non-significantly TLR1, TLR2, and IFNγ transcriptions on the spleen cells during the induction of colon cancer.

Acknowledgments: All the authors would like to acknowledge King Fahad Center for Medical Research and aiding in the conduction of this study.

Conflict of interest: None

Financial support: None

Ethics statement: The experimental protocol was established, according to the ethical guidelines and was approved by the Institutional Animal Care and Use Committee (IACUC) of King Abdulaziz University and Faculty of science (IACUC NO 2019/432067/4). The animals were obtained from the King Fahad for the Medical research. The detail of mice euthanasia and scarification methods is following the IACCU guideline. This research is not an application for clinical research, an institutional review board (IRB) is not applicable.

References

1.        Lewis SM, Williams A, Eisenbarth SC. Structure and function of the immune system in the spleen. Sci Immunol. 2019;4(33).

2.        Wang Z, He D, Zeng YY, Zhu L, Yang C, Lu YJ, et al. The spleen may be an important target of stem cell therapy for stroke. J Neuroinflammation. 2019;16(1):1-24.

3.        Morsink MA, Willemen NG, Leijten J, Bansal R, Shin SR. Immune organs and immune cells on a chip: An overview of biomedical applications. Micromachines. 2020;11(9):849.

4.        Nigam Y, Knight J. The lymphatic system 2: structure and function of the lymphoid organs. Nurs Times. 2020:44-8.

5.        Kauffmann EF, Napoli N, Genovese V, Ginesini M, Gianfaldoni C, Vistoli F, et al. Feasibility and safety of robotic-assisted total pancreatectomy: a pilot western series. Updates Surg. 2021;73(3):955-66.

6.        Zakeri S, Gorji N, Akhtari M, Moeini R. Splenectomy may have more complications than currently proven. Med Hypotheses. 2018;112:43-6.

7.        Sharma A, Viswanath B, Park YS. Role of probiotics in the management of lung cancer and related diseases: An update. J Funct Foods. 2018;40:625-33.

8.        Wang X, Qi H, Wang Q, Zhu Y, Wang X, Jin M, et al. FGFR3/fibroblast growth factor receptor 3 inhibits autophagy through decreasing the ATG12–ATG5 conjugate, leading to the delay of cartilage development in achondroplasia. Autophagy. 2015;11(11):1998-2013.

9.        Rawla P, Sunkara T, Barsouk A. Epidemiology of colorectal cancer: incidence, mortality, survival, and risk factors. Prz Gastroenterol. 2019;14(2):89.

10.     George J, Rockall T. Surgery for colorectal cancer. Surgery (Oxford). 2020;38(1):32-7.

11.     Dekker E, Tanis PJ, Vleugels JLA, Kasi PM, Wallace MB. Colorectal cancer. Lancet. 2019;394(10207):1467-80.

12.     Alhashmi M, Alshaikhi R. Hepatotoxicity in Cancer Patients Receiving Anthracyclin at KAUH: A Retrospective Study. Int J Pharm Phytopharmacol Res. 2020;10(2):82-7.

13.     Klimovich B, Mutlu S, Schneikert J, Elmshäuser S, Klimovich M, Nist A, et al. Loss of p53 function at late stages of tumorigenesis confers ARF-dependent vulnerability to p53 reactivation therapy. Proc Natl Acad Sci. 2019;116(44):22288-93.

14.     Wang LH, Wu CF, Rajasekaran N, Shin YK. Loss of tumor suppressor gene function in human cancer: an overview. Cell Physiol Biochem. 2018;51(6):2647-93.

15.     Mantovani F, Collavin L, Del Sal G. Mutant p53 as a guardian of the cancer cell. Cell Death Differ. 2019;26(2):199-212.

16.     Nakayama M, Oshima M. Mutant p53 in colon cancer. J Mol Cell Biol. 2019;11(4):267-76.

17.     Meng M, Zhong K, Jiang T, Liu Z, Kwan HY, Su T. The current understanding on the impact of KRAS on colorectal cancer. Biomed Pharmacother. 2021;140:111717.

18.     Groß O, Brummer T, Zeiser R. Immune modulatory effects of oncogenic KRAS in cancer. Nat Commun. 2020;11(1):1-11.

19.     Sameni HR, Yosefi S, Alipour M, Pakdel A, Torabizadeh N, Semnani V, et al. Co-administration of 5FU and propolis on AOM/DSS induced colorectal cancer in BALB-c mice. Life Sci. 2021;276:119390.

20.     Elbanna K, El Hadad S, Assaeedi A, Aldahlawi A, Khider M, Alhebshi A. In vitro and in vivo evidences for innate immune stimulators lactic acid bacterial starters isolated from fermented camel dairy products. Sci Rep. 2018;8(1):1-15.

21.     Hadad SE, Zakareya A, Al-Hejin A, Aldahlawi A, Alharbi M. Sustaining exposure to high concentrations of bifidobacteria inhibits gene expression of Mouse's mucosal immunity. Heliyon. 2019;5(12):e02866.

22.     Ungtrakul T, Sriprayoon T, Kusuman P, Chunnuan P, Soonklang K, Sornsamdang G, et al. Role of quantitative hepatitis B surface antigen in predicting inactive carriers and HBsAg seroclearance in HBeAg-negative chronic hepatitis B patients. Medicine. 2017;96(13).

23.     Kakiashvili E, Shakra IA, Karra N, Merei F, Bickel A, Ganam S, et al. Multiple metastases from colorectal cancer isolated to the spleen: a rare entity. Chirurgia. 2021;34(1):58-60.

24.     De Roeck L, Wuyts L, Peters B, Ruppert M. 5-Year survival after splenectomy in a patient with recurrent cutaneous melanoma: a case report. Acta Chir Belg. 2018;118(6):384-7.

25.     Efared B, Mazti A, Atsame-Ebang G, Tahiri L, El Bouhaddouti H, Hammas N, et al. An unusual site of metastasis: splenic metastastasis from a colon cancer. J Surg Case Rep. 2016;2016(11):rjw175.

26.     Wang X, Yamamoto Y, Imanishi M, Zhang X, Sato M, Sugaya A, et al. Enhanced G1 arrest and apoptosis via MDM4/MDM2 double knockdown and MEK inhibition in wild‑type TP53 colon and gastric cancer cells with aberrant KRAS signaling. Oncol Lett. 2021;22(1):1-2.

27.     Cha YJ, Kim D, Bae SJ, Ahn SG, Jeong J, Cho MK, et al. The association between the expression of nuclear Yes-associated protein 1 (YAP1) and p53 protein expression profile in breast cancer patients. PloS one. 2021;16(5):e0250986.

28.     Kamio T, Gu BW, Olson TS, Zhang Y, Mason PJ, Bessler M. Mice with a mutation in the Mdm2 gene that interferes with MDM2/ribosomal protein binding develop a defect in erythropoiesis. PLoS One. 2016;11(4):e0152263.

29.     Hobbs GA, Der CJ, Rossman KL. RAS isoforms and mutations in cancer at a glance. J Cell Sci. 2016;129(7):1287-92.

30.     Kodaz H, Kostek O, Hacioglu MB, Erdogan B, Kodaz CE, Hacibekiroglu I, et al. Frequency of RAS mutations (KRAS, NRAS, HRAS) in human solid cancer. Breast cancer. 2017;7(12):1-7.

31.     Gansmo LB, Lie BA, Mæhlen MT, Vatten L, Romundstad P, Hveem K, et al. Polymorphisms in the TP53-MDM2-MDM4-axis in patients with Rheumatoid Arthritis. Gene. 2021:145747.

32.     Wang X, Yamamoto Y, Imanishi M, Zhang X, Sato M, Sugaya A, et al. Enhanced G1 arrest and apoptosis via MDM4/MDM2 double knockdown and MEK inhibition in wild‑type TP53 colon and gastric cancer cells with aberrant KRAS signaling. Oncol Lett. 2021;22(1):1-2.

33.     Lin CC, Liao WT, Yang TY, Lu HJ, Hsu SL, Wu CC. MicroRNA‑10b modulates cisplatin tolerance by targeting p53 directly in lung cancer cells. Oncol Rep. 2021;46(2):1-3.

34.     Lehmann BD, McCubrey JA, Jefferson HS, Paine MS, Chappell WH, Terrian DM. A dominant role for p53-dependent cellular senescence in radiosensitization of human prostate cancer cells. Cell Cycle. 2007;6(5):595-605.

35.     Lv M, Tan H, Deng J, Du L, Su G, Wang Q, et al. Association of toll-like receptor 10 polymorphisms with paediatric idiopathic uveitis in Han Chinese. Br J Ophthalmol. 2020;104(10):1467-71.

36.     Dargahi N, Matsoukas J, Apostolopoulos V. Streptococcus thermophilus ST285 alters pro-inflammatory to anti-inflammatory cytokine secretion against multiple sclerosis peptide in mice. Brain Sci. 2020;10(2):126.

37.     Li JJ, Yi S, Wei L. Ocular Microbiota and Intraocular Inflammation. Front Immunol. 2020;11:3388.

38.     Roberts J, Mehta R, Curran I, Raju J. Dietary acrylamide exposure in F344 rats and colon tumor-bearing nude nu/nu mice: dataset of gene expression of cancer pathway targets and methylation status of tumor suppressor genes in colon mucosae and tumors. Data Brief. 2019;27:104763.

39.     Yang D, Zhang M, Gold B. Origin of Somatic mutations in β-catenin versus adenomatous polyposis coli in colon cancer: Random mutagenesis in animal models versus nonrandom mutagenesis in humans. Chem Res Toxicol. 2017;30(7):1369-75.

40.     Pastille E, Faßnacht T, Adamczyk A, Phuong NN, Buer J, Westendorf AM. Inhibition of TLR4 signaling impedes tumor growth in colitis-associated colon cancer. Front Immunol. 2021;12.

41.     Poillet-Perez L, White E. Role of tumor and host autophagy in cancer metabolism. Genes Dev. 2019;33(11-12):610-9.

42.     Wen X, Klionsky DJ. At a glance: A history of autophagy and cancer. InSeminars in cancer biology 2020 Nov 1 (Vol. 66, pp. 3-11). Academic Press.

43.     Liu X, Liu J, Zhao S, Zhang H, Cai W, Cai M, et al. Interleukin-4 is essential for microglia/macrophage M2 polarization and long-term recovery after cerebral ischemia. Stroke. 2016;47(2):498-504.

44.     Wu TT, Li WM, Yao YM. Interactions between autophagy and inhibitory cytokines. Int J Biol Sci. 2016;12(7):884.

45.     Shi L, Dong N, Fang X, Wang X. Regulatory mechanisms of TGF‐β1‐induced fibrogenesis of human alveolar epithelial cells. J Cell Mol Med. 2016;20(11):2183-93.

46.     Wang XH, Zhu L, Hong X, Wang YT, Wang F, Bao JP, et al. Resveratrol attenuated TNF-α–induced MMP-3 expression in human nucleus pulposus cells by activating autophagy via AMPK/SIRT1 signaling pathway. Exp Biol Med. 2016;241(8):848-53.

47.     Khan NM, Ansari MY, Haqqi TM. Sucrose, but not glucose, blocks IL1‐β‐induced inflammatory response in human chondrocytes by inducing autophagy via AKT/mTOR pathway. J Cell Biochem. 2017;118(3):629-39.

48.     Liu ZQ, Zhao S, Fu WQ. Insulin-like growth factor 1 antagonizes lumbar disc degeneration through enhanced autophagy. Am J Transl Res. 2016;8(10):4346.

QR code:

Short Link:
Quick Access

Pharmacophore
ISSN: 2229-5402


Pharmacophore
© 2021 All rights reserved