Pharmacophore an International Research Journal
CLONING AND EXPRESSION OF RECEPTOR OF EGG JELLY PROTEIN OF POLYCYSTIC KIDNEY DISEASE 1 GENE IN HUMAN RECEPTOR OF EGG JELLY PROTEIN
Hala Salim Sonbol1*, Aljazi Abdullah AlRashidi1,2
|
|
|
ABSTRACT
Autosomal dominant polycystic kidney disease (ADPKD) is caused by a mutation in the polycystic kidney disease1 (PKD1) gene, which is responsible for 85% of ADPKD cases. The PKD1 gene encodes a polycystin-1 (PC1) protein that has a large extracellular area containing many polypeptide motifs. The extracellular region of PC1 includes several well-defined peptide domains that show that it has been involved in cell-cell and/or cell-matrix interactions. One of the regions that we focused on in this study is the receptor of the egg jelly (REJ) domain. This study conveys novel findings, in which we utilized a successful methodology to clone and express the REJ protein. The REJ gene is located in many exons separated by introns, which made it impossible to clone the whole REJ region. Therefore, synthetic DNA technology was used to clone a fragment located on exon 15 of the REJ gene. The PCR technology was used to amplify the REJ region by using a universal primer to express the domain located on exon 15 in humans. The REJ from synthetic DNA was cloned by using the phosphoramidite synthetic method. Sequencing technology and bioinformatic tools were applied to confirm the validation of the coding region. The results indicated that we successfully cloned and expressed the REJ protein using the DNA synthesis method instead of the conventional methodology.
Keywords: Polycystic kidney disease, Polycystin-1, Receptor of Egg Jelly domain, PKD1 gene
Introduction
Autosomal dominant polycystic kidney disease (ADPKD) is a genetic disorder that is signified by the growth of numerous cysts in the kidneys. According to global statistics, ADPKD affects approximately 4 to 7 million people in the world. In Europe and North America, ADPKD is responsible for approximately 6 to 10% of end-stage kidney disease patients [1]. In Saudi Arabia, men are affected more than women by 95% [2].
In 1995, the International Polycystic Kidney Disease Consortium reported the final structure of the polycystic kidney disease (PKD1) gene and its protein [3]. ADPKD is caused by mutations in the PKD1 gene on chromosome 16p13.3 or the PKD2 gene on chromosome 4 and is responsible for 85% of cases [3]. The PKD1 gene encodes the polycystin-1(PC1) protein which regulates the signaling pathways that preserve the function and structure of the renal tubules. Nigro and Boletta, 2021 [4] demonstrated the functions of PC1 as a mechanosensory. Their results highlight the potential cystogenesis events that the mutation in PC1 causes. They suggested that the stiffness of the extracellular environment's mechanical stimuli could be sensed by PC1. These findings have hypothetically important implications for understanding ADPKD pathophysiology and the opportunity of designing novel treatments [4].
PC1 is an integral transmembrane protein and a member of a novel family of proteins with a multidomain structure [5]. It has a predicted mass of approximately 460 kDa and a glycosylated mass of 520 kDa. It also consists of transmembrane domains, a large N-terminal extracellular domain mediating cell-cell and cell-extracellular matrix binding, and a carboxy-terminal region [6]. The extracellular domain contains a novel combination of motifs that are predicted to be involved in cell-cell and cell-matrix interactions [7]. This region contains two leucine-rich repeats flanked by cysteine-rich domains (LRR), a C-type lectin domain (CLD), a cell wall integrity and stress response component (WSC) domain, 16 immunoglobin-like domains (PKD repeats), a low-density lipoprotein-like domain (LDL-A domain), a GPS domain, and a receptor of egg jelly protein (REJ) domain. The domains in the PC1 protein could be capable of binding ligands in the extracellular matrix (ECM) [7].
In this study, we cloned and expressed the receptor of the egg jelly (REJ) domain, which is the largest domain located in the extracellular region of PC1 (GenBank: AAC37576.1) (residues 2146 to 3109). We chose the REJ gene from 2151 to 2451 for two reasons: First, the PC1 protein has a single domain of REJ, which is the largest domain in the N-terminal of PC-1 protein [8]. Second, few copies that are expressed in the tissues of the kidneys and testicles exist, and these proteins are characterized by similar biological functions.
This REJ domain of PC1 includes several well-defined peptide domains, which are predicted to be involved in cell-cell and/or cell-matrix interactions. It is also one of the major components in the PC1 ectodomain, which extends to approximately 1000 amino acids. Approximately 230 mutations exist, which include 80 missense mutations of the REJ region, and among these missense mutations, the authors of [9] predicted that 65 are the disease-causing ones. the REJ region is encoded by PKD1 exons15 to 23 [9].
At the GPSG-protein-coupled proteolytic site, PC1 undergoes cleavage, and this process involves the entire REJ region (10). GPS cleavage is an essential process for both kidney function and structure, and the number of mutations at the REJ region affects GPS cleavage by disruption [10].
We aimed to produce a recombinant form of REJ-His fusion protein in a bacterial host and evaluate its biophysical properties. We also aimed to investigate the molecular expression mechanisms and predict the molecular structure of the extracellular domains of PC1 that could assess its potential importance in ADPKD etiology.
Materials and Methods
The PCR reagents and universal primers were obtained all from Macrogen (Korea) and the work was performed at King Fahad medical research center. The kits and general reagents were obtained to construct the recombinant plasmid, digestion enzymes, and CutSmart Buffer from New England BioLabs (UK). The sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) reagents were purchased from Merck (Germany) together with the expression solution, Luria–Bertani, from SolarBio (China).
REJ Gene Cloning
Based on the sequence obtained from GenBank, we synthesized residues of the 2151 to 2451 genes with the accession number AAC37576.1 using the phosphoramidite synthetic method [11]. In this experiment, the DNA synthesis technique was used instead of the traditional amplification method due to the difficulty of amplifying the REJ gene with standard PCR methods. Therefore, the REJ gene sequence was designed and manufactured at Synbio (USA) and cloned with a pUC57-Amp cloning vector. The digested vector was added to the loading dye and then separated on a 1.2 % agarose gel electrophoresis. In this current study, all plasmids were digested using Snap Gene Viewer software [12].
REJ Gene Amplification
A PCR reaction was performed, followed by restriction enzyme digestion to amplify the REJ constructs. The PCR reaction included the pUC57-REJ constructs (1μl) and forward and reverse M13 primers (2μL of M13 F, GTAAAACGACGGCCAGT, and M13R, GTCATAGCTGTTTCCTG). A master mix (25μL) (Sigma Aldrich, USA) was used, and deionized water was added to a total volume of 50μL. The forward and reverse primers were used to generate a 300 bp DNA fragment representing the coding region of the REJ gene. The PCR products were electrophoresed using 0.5 % (w/v) agarose gel in a 1X TPE buffer. Ethidium bromide (0.5 µg/L) was used to stain the DNA in agarose gel. Electrophoresis was performed at 80V. The PCR products were visualized using an alpha imager (UVP, UK).
Sub-Cloning of REJ Gene into PET-21a (+) Expression Vector
The REJ gene fragment that had been confirmed via the DNA sequencing was subcloned into the pET-21a (+) expression vector to make plasmid pET-21a (+)-REJ. First, double digestion reactions were performed using XhoI and BamHI restriction endonuclease. The reaction included a pET-21a (+) expression vector (2µl) and a BamHI and XhoI restriction enzyme (1µL). Then, a 10x (5µL) NEB buffer r3.1 (restriction enzyme buffer) was added to the mixture. Finally, nuclease-free water was added up to a total volume of 50µL. The mixture was incubated for 1 hour at 37°C. The restriction map of the pET-21a (+) expression vector is shown in Figure 1, indicating the production of the fusion protein as His-tagged [13].
|
|
|
Figure 1. Restriction map of pET-21a (+) expression vectors (5369bp) |
A ligation reaction was provoked by using a 1:3 insert-to-vector ratio. The amount of the pET-21a (+) expression vector was calculated to estimate the inserted REJ gene needed using NEB tool software. The ligation reaction was performed using a T4 DNA ligase enzyme (1µL) and incubated overnight at 4ºC. In 1 hour, the transformation process was performed using BL21-DE3 competent cells (Sigma-Aldrich, US). Competent E. coli cells that contained the pET-21a (+)-REJ were spread onto Luria–Bertani (LB) plates containing 100 μg/ml ampicillin and were left to grow overnight at 37°C [14].
Identification of Positive Clones
In order to select a positive colony with a plasmid containing the REJ gene (pET21a (+)-REJ, a colony PCR test was performed. The colony PCR procedure had been done by selecting 27 colonies on a culture plate and picking each colony with a 10-ul pipette tip and mixing each of them with 10 uL PCR super mix, that contains 5μL master mix, the T7 promoter right primer (1μ, TAATACGACTCACTATAGGG), T7 terminator left primer (1μL, GCTAG-TTATTGCTCAGCGG), and 3μL of dH2O.PCR reaction conditions were programmed at 94 ºC for 4 min, cycling for 32 times (94 ºC for 30 Sec, 48 ºC for 30 Sec, and 72 ºC for 1 min), and finally the end of cycling at 72 ºC for 10 min. The annealing temperature for used primers was 48 °C [15].
Plasmid DNA Purification and Extraction
The positive plasmid with a colony PCR was confirmed. The selected positive colony was left for an overnight culture, followed by DNA isolation for a subsequent sequencing reaction. The selected bacterial clone was picked up from the plate with a sterile toothpick, suspended in 5 ml of LB media containing 1% (w/v) ampicillin (5µl), and left overnight in a 190-rpm orbital shaker at 37 °C. The pET-21a (+)-REJ was isolated with the ZymoPURE™ II Plasmid Maxiprep kit according to the manufacturer’s protocol [16].
After extraction and purification, the pET-21a (+)-REJ was sent to the King Fahd medical research center, Jeddah, KSA, for sequencing to prove the identity of the plasmid sequence. The resulting pET-21a (+)-REJ sequence was analyzed using the Thermo Hitachi ABI Applied Biosystems 3500XL Genetic DNA Analyzer, Japan. The results were displayed using Finch TV [17]. and then multiple sequence alignment software was used (European Bioinformatics Institute), to align the REJ sequence (GenBank: AAC37576.1) with the sequencing result [18].
REJ-His Fusion Protein Expression
E. coli BL-21 was transformed as the expression system with the pET-21a (+) positive clones harboring the plasmid were picked and left to grow overnight in liquid LB containing 100 μg/mL of ampicillin at 37°C to control the expression of the desired protein. After reaching 0.6 OD 600nm, the expression was induced using isopropyl-1-thio-β-D-galactopyranoside (IPTG). The expression was optimized using different IPTG concentrations (0.5,1,1.5 mM), different times (4, 5, 6 hours), and temperatures (20°C,25°C,37°C). After optimization, E. coli cells were cultivated in larger volumes and centrifuged in the final suspension at 6000rpm at 4 °C for 10 min to remove the cellular debris. Then, the cells were re-suspended in a lysis buffer containing 50 mM NaH2PO4, 300 mM NaCl, and 10 mM imidazole. The culture mixture was disrupted with sonication, and the lysate was centrifuged at 6000 rpm for 10 min at 4 °C to pellet the supernatant aliquots to determine the recombinant protein expression via SDS-PAGE and Coomassie brilliant blue staining. The inclusion bodies were parted and solubilized by a denaturing lysis buffer containing 100 mM NaH2PO4, 10 mM Tris-HCl, and 6 M urea, then aliquots from the supernatant and pellet were used to determine the recombinant protein expression. Twenty percent SDS-PAGE was used to detect the REJ-His fusion protein solubility in the supernatant and pellet [19, 20].
Results and Discussion
REJ proteins support Ca2+ influx, and the localization of the REJ protein domains in the extracellular region of the PC1 protein allows it to interact with the ECM proteins and provides an excellent example model to investigate its function in ADPKD [7].
REJ Gene Cloning
The bands representing the vector and the digested vector were visualized in an agarose gel electrophoresis obtained from Synbio. Two segments of the digested pUC57 plasmid with a size of 500 and 1200 bp were visualized in lane 1, while in lane 2 and the uncut pUC57 plasmid was 5000 bp (Figure 2).
|
|
|
Figure 2. Gel electrophoreses analysis of the digested and undigested pUC57 plasmid in 1.2% (w/v) agarose gel electrophoresis. Lane M is a DNA marker. Lane 1 contains pUC57 plasmid digested by ApaL-I, presenting 500bp and 1200bp. Lane 2 contains the uncut pUC57 plasmid containing 5000bp. |
The REJ gene theoretical sequence obtained from the REJ domain of polycystin-1 from the NCBCI-BLAST (GenBank: AAC37576.1) was compared with the sequence obtained from our research. The gel electrophoresis results in the lab presented identical matches between these sequences. The REJ gene sequence showed 300 bp, as shown in Figure 5. The sequence alignment between the theoretical REJ gene sequence was compared with the REJ sequence produced from the sequencing reaction in the lab. The result obtained from the King Fahad medical research center lab using a Sanger Sequencing Analyzer is shown in Figures 3 and 4 which showed the Sequencing Chromatograms of the REJ gene.
|
|
|
Figure 3. The alignment between the pUC 57-REJ obtained from sequencing and the theoretic (GenBank: AAC37576.1) REJ DNA sequence. Differences are marked by a dot (.) and matches are marked with a star (*). |
|
|
