Pharmacophore an International Research Journal
Pharmacophore
Submit Manuscript
Open Access | Published: 2021 - Issue 3

MOLECULAR CHARACTERIZATION OF PROPROTEIN CONVERTASE SUBTILISIN/KEXIN TYPE 9 GENE MUTATIONS IN VIETNAMESE PATIENTS WITH HYPERCHOLESTEROLEMIA

Phuong Dong Tran Nguyen1, Nang Hoang Pham1, Phuong Kim Truong1*

 

  1. Faculty of Biotechnology, Ho Chi Minh City Open University, Ho Chi Minh City, Vietnam.

ABSTRACT

Proprotein convertase subtilisin/kexin type 9 (PCSK9) is an enzyme that plays a key role in regulating the circulating low density lipoprotein cholesterol (LDL-C). Among the PCSK9 variants, while gain-of-function mutations aggravate the degradation of LDL receptors, leading to familial hypercholesterolemia (FH), whereas loss-of-function mutations increase LDL receptor levels, lower LDL levels, and prevent coronary heart disease. The variants of PCSK9 have not been clarified in the Vietnamese population yet. Hence, the present study aimed to present the molecular characteristics of PCSK9 gene in Vietnamese hypercholesterolemia patients. A total of 26 peripheral blood samples were collected from the patients who were diagnosed with Hypercholesterolemia in a local hospital. The PCR-sequencing method was applied to amplify and sequencing PCSK9. Then, variant screening was performed by comparing with the reference sequence (NG_009061). 
60 variants were identified in 14 of 26 patients (accounting for 53.85%): 50 (83.33%) variants were identified as novel variants among which, 24 were probably damaging, 11 were benign, and 15 were variants of uncertain significance. Functional effects of novel variants were predicted by using PolyPhen-2 and FSPLICE. This study analyzed the variants spectrum in Vietnamese Hypercholesterolemia patients and expresses the importance of genetic diagnosis in FH patients.

Keywords: PCSK9 gene, Familial Hypercholesterolemia, Mutation, Vietnamese


Introduction

Familial Hypercholesterolemia (FH, OMIM: #143890), also known as Familial Hypercholesterolemia type 2 or Fredrickson Class 2A Hyperlipidemia, is a prevalent autosomal dominant hereditary genetic metabolic disease [1]. The prevalence of the heterozygous form of FH (HeFH) is about 1/244 individual, while that of the homozygous form (HoFH) is about 1/160,000-300,000 [2]. FH is characterized by extremely raised levels of total cholesterol (TC) and low-density lipoprotein cholesterol (LDL-C) in the circulation, the presence of tendon xanthomas and accelerated atherosclerosis, resulting in an increased risk of premature cardiovascular events [1, 3-6]

Accumulating evidence of molecular pathogenesis of FH, FH can be caused by mutations in either Proprotein convertase subtilisin kexin 9 (PCSK9), Apolipoprotein B (APOB), or LDL receptor (LDLR), and others singly or combinations [4, 5, 7, 8]. Up to date, more than 10000 genetic variants of those genes have been identified and reported in several public databases, such as Clinvar, LOVD, etc. From all mutations described, approximately 85-90%, 1-12% of patients with FH have been associated with LDLR mutations, and APOB mutations, respectively. Additionally, 2-4% gain-of-function PCSK9 mutations were identified in the patients of FH [9, 10].

Located on the p-arm of chromosome 1 (p32.3), PCSK9 gene, also known

as Neural Apoptosis­ Regulated Convertase­1 (NARC1), encodes for the 692 amino acids proprotein convertase subtilisin/kexin type 9, a proprotein convertase of subtilase family, and predominantly expressed in the kidney, liver, cerebellum, and small intestine [11]. The PCSK9 protein plays an important role in the LDL metabolism, in detail, PCSK9 functions as a chaperone to mediate the degradation of LDL receptors by interacting with the extracellular domain leading to the degradation of lysosome, which is directly related to high LDL-C level in plasma [12].
Two types of mutations: Gain-of-function (GOF) and Loss-of-function (LOF) have been identified in the variants of the PCSK9 gene [11]. Many GOF mutations in PCSK9, such as R496W, R469W (in C-­terminal); R128S, F216L, R215H (in the catalytic domain); D129N, S127R (in prodomain); etc., have been reported. Its function is to decrease the number of LDLRs at the cell surface, leading to hypercholesterolemia and increase the risk of coronary heart disease (CHD). While the LOF mutations, including C679X, A443T (in C­-terminal); L253F (in the catalytic domain); Y142X, G106R, R46L (in prodomain); etc., are associated with lower cholesterol levels. As a result, it leads to the reduction of LDL-C in the bloodstream and also CHD risk [12]. The studies related to the genetic screening of genes involves in cholesterol metabolism will light out the era of early diagnosis of FH. Despite the prevalence and significant benefits associated with FH, most of those molecular screenings have been conducted in developed countries, including United Kingdom, France, Germany, Taiwan, China, Japan, etc. Especially, in Vietnam, it is markedly under-recognized, under-diagnosed, and under-treated, and is a public health problem that requires attention [10]. Molecular screening of PCSK9 has not been previously described. Therefore, this study aimed to evaluate the genotype variants of PCSK9 in Vietnamese Hypercholesterolemia patients.

Materials and Methods

Ethics statement, sample collection

The Institutional Ethics Broad approval was obtained from Medic Medical Center, Ho Chi Minh City, Vietnam (Ethics code: 02/06/2020/HĐĐĐ/YTHH). All patients enrolled in the study signed the consent forms to approve the usage of the samples for laboratory work and analysis.

A total of 26 blood samples from Hypercholesterolemia patients were collected at Medic Medical Center, Ho Chi Minh, Vietnam. The patients were diagnosed with increased the concentration of TC and LDL-C (LDL-C ≥4.13 mmol/L, TC ≥6.20 mmol/L).

DNA isolation, amplification, and analysis of PCSK9 gene

Genomic DNA was isolated from whole blood samples using TopPURE ® Blood DNA Extraction Kit (HI-132). The amplification of targets was performed by the PCR-sequencing method. The used primers are shown in Table 1. The PCR assay was done in a total volume of 50μl, containing 100 ng template. PCR reaction was subjected to initial denaturation at 95°C for 5 min, followed by 35 cycles at 95°C for 30 s, 56°C for 30 s, 72°C for 30 s, and finally 72°C for 10 minutes. PCR products were directly loaded onto a two percent agarose gel, stained with GelRed, and visualized directly under UV illumination. The PCR products were sequenced to identify whether there were mutations in exon 1 and 2 of PCSK9 gene in comparison to the references of PCSK9 gene (NG_009060; NM_000527).

 

Table 1. Primers used in the current study

Primer

Sequence

Reference

FO-E1F

AAAACGACGGCCAGTTGAACTTCAGCTCCTGCACAG

Ohta et al., 2016

FO-E1R

ACTCCACTTCCTCTCTTACAT

FO_E2F

AAAACGACGGCCAGTTGGTCCGCATTTGGTAACTTC

FO-E2R

CTCAATACATACTTGCTGTCC

Note: E1: exon 1; E2: exon 2.

 

The position of the novel variants in its encoded protein was identified based on the comparison with the reference sequence NP_777596. The functional effect of each variant was classified as pathogenic or non-pathogenic based on the database of ClinVar and LOVD. For those variants, which have not been previously recorded, the PolyPhen-2 and FSPLICE were used for predicting the functional effects.

 

Results and Discussion

 

Clinical profile

Of all 26 blood samples included in this study, which were clinical diagnosis as definite hypercholesterolemia based on the criteria of National Cholesterol Education Program Adult Treatment Panel III - NCEP ATP III (Total cholesterol ≥ 6.2 mmol/L; LDL cholesterol ≥ 4.1 mmol/L; HDL cholesterol < 1.03 mmol/L). Table 2 summarized the clinical characteristics of patients. 

 

Table 2. Clinical profile of index patients

Characteristic

Index level

Age (years)

49±5.64

Gender (Male/Female)

57.69%/42.31%

TC (mmol/L)

6.97±0.43

LDL-C (mmol/L)

4.32±0.46

HDL-C (mmol/L)

1.38±0.30

TG (mmol/L)

3.63±1.28

Note: TC: Total cholesterol; TG: Triglyceride; LDL-C: Low-Density Lipoprotein Cholesterol; HDL-C: High Density Lipoprotein Cholesterol. The data were expressed as mean±SD.

 

Annotation of variants in hypercholesterolemia subject

A total of 60 variants were identified in 14 of 26 patients (accounting for 53.85%). Among variants, 10 were found to correspond to previously published variants (accounting for 16.67%) (Table 3) and 50 were identified as novel variants (accounting for 83.33%) (Table 4; Figure 1).

 

Figure 1.  Variants located in the signal peptide domain and N-terminal prodomain of PCSK9

 

 In the total of 10 variants, one frame insertion was identified as benign in FH pathogenesis, and nine were missense variants, among which one was probably pathogenic, four were benign/likely benign, and 5 variants had uncertain significance. Among them, the variant of c.63_64insCTG (p.L21_L22insL) was located at the domain of the signal peptide (residue 1 to 30). All missense variants were located at the N-terminal prodomain (residue 31 to 69).

 

Table 3. 10 Known variants of PCSK9 identified in the study subjects

Type of variants

Nucleotide

change

Amino acid

change

rs no.

Pathogenic*

Frame insertion

c.63_64insCTG

p.L21_L22insL

rs371488778

B

Missense

c.158C>T

p.A53V

rs11583680

B/LB

c.212C>T

p.P71L

rs569379713

LP

c.242T>A

p.V81E

N/A

VUS

c.260A>T

p.H87Q

N/A

VUS

c.278G>A

p.R93H

rs763855534

LB

c.298G>A

p.A100T

rs564681731

VUS

c.314G>A

p.R105Q

rs754143671

VUS

c.335T>G

p.L112R

rs1021372164

VUS

c.350G>A

p.G117D

rs761417131

LB

 Note: * data was classified based on the database of Clinvar and/or LOVD; N/A: Not assignment; B: benign; LB: Likely benign; LP: Likely pathogenic; VUS: Variant of uncertain significance.

 

A total of 50 novel variants were identified of which 11 were frame insertion (seven located in exon 1, three located in exon 2, and one located in the splicing region); 37 were missense variants, (35 located in exon 2, and 2 located in the splicing region); and 2 were nonsense variants (located in exon 2). The functional prediction of those novel variants was performed by PolyPhen-2 and FSPLICE. The results showed that among 37 missense variants, 11 were probably damaging, 11 were benign, and 2 were VUS. All frameshift variants and nonsense variants were identified as VUS.

 

Table 4. The novel variants of PCSK9 identified in hypercholesterolemia patients.

Type of variants

Nucleotide

change

Amino acid

change

Location

Pathogenic+

Frequency

Frameshift

c.41_42insT

p.P14fs

Exon 1

VUS

1 of 14 (7.14%)

c.91_92insT/G

p.Q31fs

Exon 1

VUS

1 of 14 (7.14%)

c.93_94insA

p.E32fs

Exon 1

VUS

1 of 14 (7.14%)

c.131_132insT

p.A44fs

Exon 1

VUS

1 of 14 (7.14%)

c.164_165insT

p.A55fs

Exon 1

VUS

1 of 14 (7.14%)

c.172_173insT

p.H58fs

Exon 1

VUS

1 of 14 (7.14%)

c.204_205insT

p.K69fs

Exon 1

VUS

1 of 14 (7.14%)

c.208_209insC

p.D70fs

Exon 2

VUS

1 of 14 (7.14%)

c.212_213insA

p.P71fs

Exon 2

VUS

1 of 14 (7.14%)

c.225_226insA

p.P75fs

Exon 2

VUS

1 of 14 (7.14%)

c.208-1_208-2insC

N/A

Splicing Region

VUS

1 of 14 (7.14%)

Nonsense

c.234C>A

p.Y78*

Exon 2

VUS

1 of 14 (7.14%)

c.266C>A

p.S89*

Exon 2

VUS

2 of 14 (14.28%)

Missense

c.214T>C

p.W72R

Exon 2

P. damaging

2 of 14 (14.28%)

c.222G>C

p.L74F

Exon 2

P. damaging

1 of 14 (7.14%)

c.224C>T

p.P75L

Exon 2

P. damaging

2 of 14 (14.28%)

c.226G>C

p.G76R

Exon 2

P. damaging

1 of 14 (7.14%)

c.232T>C

p.Y78H

Exon 2

P. damaging

3 of 14 (21.43%)

c.235G>A

p.V79M

Exon 2

Benign

3 of 14 (21.43%)

c.239T>C

p.V80A

Exon 2

P. damaging

2 of 14 (14.28%)

c.241G>A

p.V81M

Exon 2

P. damaging

1 of 14 (7.14%)

c.242T>C

p.V81A

Exon 2

P. damaging

3 of 14 (21.43%)

c.245T>A

p.L82Q

Exon 2

P. damaging

7 of 14 (50.00%)

c.247A>C

p.K83Q

Exon 2

P. damaging

4 of 14 (28.57%)

c.251A>T

p.E84V

Exon 2

P. damaging

3 of 14 (21.43%)

c.253G>C

p.E85Q

Exon 2

Benign

2 of 14 (14.28%)

c.274G>A

p.E92K

Exon 2

Benign

1 of 14 (7.14%)

c.274G>C

p.E92Q

Exon 2

Benign

1 of 14 (7.14%)

c.280A>G

p.T94A

Exon 2

P. damaging

3 of 14 (21.43%)

c.280A>T

p.T94S

Exon 2

P. damaging

2 of 14 (14.28%)

c.281C>A

p.T94N

Exon 2

P. damaging

1 of 14 (7.14%)

c.283G>A

p.A95T

Exon 2

Benign

4 of 14 (28.57%)

c.302A>T

p.Q101L

Exon 2

Benign

1 of 14 (7.14%)

c.303G>T

p.Q101H

Exon 2

Benign

5 of 14 (35.71%)

c.305C>A

p.A102D

Exon 2

P. damaging

2 of 14 (14.28%)

c.310C>A

p.R104S

Exon 2

P. damaging

2 of 14 (14.28%)

c.329A>G

p.K110R

Exon 2

P. damaging

1 of 14 (7.14%)

c.332T>C

p.I111T

Exon 2

Benign

1 of 14 (7.14%)

c.334C>A

p.L112M

Exon 2

P. damaging

2 of 14 (14.28%)

c.338A>C

p.H113P

Exon 2

P. damaging

1 of 14 (7.14%)

c.346C>T

p.H116Y

Exon 2

Benign

3 of 14 (21.43%)

c.352C>A

p.L118I

Exon 2

Benign

2 of 14 (14.28%)

c.355C>G

p.L118V

Exon 2

Benign

3 of 14 (21.43%)

c.368T>C

p.L123P

Exon 2

P. damaging

1 of 14 (7.14%)

c.370G>T

p.V124L

Exon 2

P. damaging

2 of 14 (14.28%)

c.371T>C

p.V124A

Exon 2

P. damaging

1 of 14 (7.14%)

c.377T>C

p.M126T

Exon 2

P. damaging

1 of 14 (7.14%)

c.385G>C

p.D129H

Exon 2

P. damaging

3 of 14 (21.43%)

c.399+1G>T

N/A

Splicing Region

VUS

1 of 14 (7.14%)

c.399+2T>A

N/A

Splicing Region

VUS

1 of 14 (7.14%)

Note: *Codon stop; +data was predicted by PolyPhen-2 and FSPLICE. P. damaging: probably damaging; VUS: Variant of uncertain significance.

 

Historically, the diagnosis of FH was based on clinical characteristics, including the high LDL-C levels, physical examination findings, and clinical/familial history of hypercholesterolemia and/or cardiovascular diseases [13-16]. In recent years, numerous molecular diagnostic techniques have been developed, including polymerase chain reaction and genome sequencing for genetic testing [17]. In this study, the PCR-sequencing was applied to investigate the genotype variants of PCSK9 in Vietnamese hypercholesterolemia patients. In 26 hypercholesterolemia patients, 53.85% carried a total of 60 PCSK9 variants Among which 10 were in Clinvar and LOVD and 50 were newly identified in this study. Of 10 known variants, 4, 1, and 5 were identified as benign/Likely benign, Likely damaging, and VUS, respectively. The functional prediction of these 50 novel variants was performed by PolyPhen-2 and FSPLICE. As the results, 24, 11, and 15 of the novel variants were identified as probably damaging, benign, and VUS, respectively. Notably, among 14 patients within the identified variants, the patient, who was diagnosed with the highest levels of hypercholesterolemia, contained the highest number of novel variants (18 variants), and all of them were located in the exon 2 of PCSK9. It was necessary to perform an in vivo functional analysis to determine those variants as whether or not pathogenic in hypercholesterolemia.

This study had a limitation. The familial history of patients was not recorded. Therefore, to further study whether these novel variants could be considered the cause of hypocholesterolemia, family studies should be conducted.

 

Conclusion

 

In conclusion, this study annotated 50 novel variants of PCSK9 on the clinical phenotype of patients with hypocholesterolemia. By in vivo functional analysis, 24 of 50 novel variants (48.00%) were predicted as probably damaging. To further study, in vivo functional analysis, as well as family studies, will be performed to determine those variants as whether or not pathogenic in familial hypercholesterolemia.

Acknowledgments: We wish to express our thanks to the research project sponsored by the Ministry of Education and Training, Vietnam (Grant number: B2018-MBS-08), and Ho Chi Minh City Open University, HCMC, Vietnam (Grant number: B2018-MBS-08). We also thank Medic Medical Center for its genuine support throughout this research work.

Conflict of interest: None

Financial support: This research received funding sponsored by the Ministry of Education and Training, Vietnam and Ho Chi Minh City Open University, HCMC, Vietnam under grant number B2018-MBS-08.

Ethics statement: This study was approved by the Institutional Review Board (IRB) of Medic Medical Center and the protocols used in the study were approved by the Committee of Human Subjects Protection of the Medic Medical Center, Ho Chi Minh City, Vietnam (Ethics code: 02/06/2020/HĐĐĐ/YTHH).

References

1.        Goldstein JL, Brown MS. Binding and degradation of low density lipoproteins by cultured human fibroblasts: comparison of cells from a normal subject and from a patient with homozygous familial hypercholesterolemia. J Biol Chem. 1974;249(16):5153-62.

2.        Cuchel M, Bruckert E, Ginsberg HN, Raal FJ, Santos RD, Hegele RA, et al. Homozygous familial hypercholesterolaemia: new insights and guidance for clinicians to improve detection and clinical management. A position paper from the Consensus Panel on Familial Hypercholesterolaemia of the European Atherosclerosis Society. Eur Heart J. 2014;35(32):2146-57. doi:10.1093/eurheartj/ehu274.

3.        Khachadurian AK. The inheritance of essential familial hypercholesterolemia. Am J Med. 1964;37(3):402-7. doi:10.1016/0002-9343(64)90196-2.

4.        Soran H, Adam S, Mohammad JB, Ho JH, Schofield JD, Kwok S, et al. Hypercholesterolaemia – practical information for non-specialists. Arch Med Sci. 2018;14(1):1-21, doi:10.5114/aoms.2018.72238.

5.        Pejic RN. Familial hypercholesterolemia. Ochsner J. 2014;14(4):669-72.

6.        Mohamadpour M, Shahmir P, Asadi M, Asadi S, Amraei M. Investigating the Effect of Saffron Petal Extract on Antioxidant Activity and Inflammatory Markers in Hypercholesterolemic Rats‎‎. Entomol Appl Sci Lett. 2020;7(3):13-22.

7.        Iacocca, MA, Hegele RA. Recent advances in genetic testing for familial hypercholesterolemia. Expert Rev Mol Diagn. 2017;17(7):641-51. doi:10.1080/14737159.2017.1332997.

8.        Hori M, Ohta N, Takahashi A, Masuda H, Isoda R, Yamamoto S, et al. Impact of LDLR and PCSK9 pathogenic variants in Japanese heterozygous familial hypercholesterolemia patients. Atherosclerosis. 2019;289:101-8, doi:10.1016/j.atherosclerosis.2019.08.004.

9.        Polychronopoulos G, Tziomalos K. Treatment of heterozygous familial hypercholesterolemia: what does the future hold? Expert Rev Clin Pharmacol. 2020;13(11):1229-34. doi:10.1080/17512433.2020.1839417.

10.     Pham NH, Truong PK, Lao TD, Le TAH. Proprotein Convertase Subtilisin/Kexin Type 9 Gene Variants in Familial Hypercholesterolemia: A Systematic Review and Meta-Analysis. Processes. 2021;9(2):283. doi:10.3390/pr9020283.

11.     Wiciński M, Żak J, Malinowski B, Popek G, Grześk G. PCSK9 signaling pathways and their potential importance in clinical practice. EPMA J. 2017;8(4):391-402. doi:10.1007/s13167-017-0106-6.

12.     Abifadel M, Rabès JP, Jambart S, Halaby G, Gannagé‐Yared MH, Sarkis A, et al. The molecular basis of familial hypercholesterolemia in Lebanon: Spectrum of LDLR mutations and role of PCSK9 as a modifier gene. Hum Mutat. 2009;30(7):E682-91, doi:10.1002/humu.21002.

13.     Sturm AC, Knowles JW, Gidding SS, Ahmad ZS, Ahmed CD, Ballantyne CM, et al. Clinical Genetic Testing for Familial Hypercholesterolemia. J Am Coll Cardiol. 2018;72(6):662-80, doi:10.1016/j.jacc.2018.05.044.

14.     Bouhairie VE, Goldberg AC. Familial Hypercholesterolemia. Cardiol Clin. 2015;33(2):169-79. doi:10.1016/j.ccl.2015.01.001.

15.     Najam O, Ray KK. Familial Hypercholesterolemia: a Review of the Natural History, Diagnosis, and Management. Cardiol Ther. 2015;4(1):25-38. doi:10.1007/s40119-015-0037-z.

16.     Alzahrani S, Alosaimi ME, Oways FF, Hamdan AO, Suqati AT, Alhazmi FS, et al. Knowledge of Cardiovascular Diseases and Their Risk Factors among the Public in Saudi Arabia. Arch Pharm Pract. 2019;10(3):47-51.

17.     Moldovan V, Banescu C, Dobreanu M. Molecular diagnosis methods in familial hypercholesterolemia. Anatol J Cardiol. 2020;23(3):120-7. doi:10.14744/AnatolJCardiol.2019.95038

QR code:

Short Link:
Quick Access

Pharmacophore
ISSN: 2229-5402


Pharmacophore
© 2021 All rights reserved